pCIneoMyc UNC119Ab
(Plasmid
#128332)
-
PurposeMammalian expression vector of Myc-tagged human UNC119A isoform b
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUNC119
-
SpeciesH. sapiens (human)
-
GenBank ID9094
-
Entrez GeneUNC119 (a.k.a. HRG4, IMD13, POC7, POC7A)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gataggcacctattggtcttactgacat
- 3′ sequencing primer Gaacctgaaacataaaatgaat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIneoMyc UNC119Ab was a gift from Yutaka Hata (Addgene plasmid # 128332 ; http://n2t.net/addgene:128332 ; RRID:Addgene_128332) -
For your References section:
UNC119 is a binding partner of tumor suppressor Ras-association domain family 6 and induces apoptosis and cell cycle arrest by MDM2 and p53. Iwasa H, Sarkar A, Shimizu T, Sawada T, Hossain S, Xu X, Maruyama J, Arimoto-Matsuzaki K, Withanage K, Nakagawa K, Kurihara H, Kuroyanagi H, Hata Y. Cancer Sci. 2018 Sep;109(9):2767-2780. doi: 10.1111/cas.13706. Epub 2018 Jul 28. 10.1111/cas.13706 PubMed 29931788