pDN-D2irTNG5kwh
(Plasmid #128279)

• Purpose: Mammalian linearizer gene circuit in a Flp-In expression system with a hTetR::EGFP fusion protein
• Depositing Lab: Gabor Balazsi
• Publication: Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w.

Backbone

• Vector backbone: pcDNA5/FRT
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5070
• Total vector size (bp): 7505
• Vector type: Mammalian Expression, Synthetic Biology ; Flp-In expression vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTetR::NLS::EGFP
• Alt name: hTetR
• Alt name: Nuclear localization sequence
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 3414
• Promoter: CMV-D2ir promoter
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: ACGGGCCAGATATACGCGTT
• 3′ sequencing primer: CCATAGAGCCCACCGCATCCC

Resource Information

• Supplemental Documents:
  • pDN-D2irTNG5kwh.gb
• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid encodes a mammalian synthetic gene circuit with a fusion humanized TetR::NLS::EGFP protein, which can bind to the CMV-derived promoter with two tetO2 sites (CMV-D2ir) to repress its own expression in a negative feedback loop. The plasmid is used as an intermediate backbone towards constructing pDN-D2irTN2AG5kwh. It is able to integrate into genomic FRT sites.