pMTG8-Amp-FRT
(Plasmid #128277)

• Purpose: TIP-LITer2.0-KRAS(G12V) gene circuit with the following architecture: CMV-TetOx2-TetR-LOV-TIP-P2A-KRAS(G12V)-P2AGFP
• Depositing Lab: Gabor Balazsi
• Publication: Guinn et al Nucleic Acids Res. 2019 Jul 3. pii: 5527975. doi: 10.1093/nar/gkz556.

Backbone

• Vector backbone: pMTG05-Amp-FRT
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: TetR-LOV-TIP
• Alt name: Tetracycline repressor, Light-oxygen-voltage-sensing domain, tet-inhibiting peptide
• Species: Synthetic
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tttttggctactacacttg

Gene/Insert 2

• Gene/Insert name: EGFP
• Species: Synthetic
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTACGGCAAGCTGACCCTGAA

Gene/Insert 3

• Gene/Insert name: KRAS(G12V)
• Species: Synthetic
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtccagtactttattggggt

Resource Information

• Supplemental Documents:
  • pMTG08.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional relevant information can be found from this publication: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471