pMTG07-Amp-FRT
(Plasmid #128276)

• Purpose: Gene circuit with the following architecture: 5xUAS-mNeonGreen--CMV-Gal4-VVD-p65
• Depositing Lab: Gabor Balazsi
• Publication: Guinn et al Nucleic Acids Res. 2019 Jul 3. pii: 5527975. doi: 10.1093/nar/gkz556.

Backbone

• Vector backbone: pDN-D2irTN2aG5kwh
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gal4-VVD-p65
• Species: Synthetic
• Insert Size (bp): 1528
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: actttccaaaatgtcgtaacaactccgc

Resource Information

• Supplemental Documents:
  • pMTG07.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional relevant information can be found from these publciations: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471

https://www.nature.com/articles/nmeth.1892.pdf?origin=publication_detail