pMito-mCherry-FRB_IRES_FKBP(III)-GBPen
(Plasmid #128268)

• Purpose: Bicistronic vector to express mitochondrial targeted mCherry-FRB (MitoTrap) as well as 3x FKBP-GBPenhancer (GFP Nanobody with 3 FKBP domains).
• Depositing Lab: Stephen Royle
• Publication: Kuey et al J Cell Sci. 2019 Nov 6;132(21). pii: jcs.234955. doi: 10.1242/jcs.234955.

Backbone

• Vector backbone: pmCherry-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MitoTrap
• Alt name: Mito-mCherry-FRB
• Species: Synthetic
• Insert Size (bp): 1107
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TTTAGTGAACCGTCAGATC

Gene/Insert 2

• Gene/Insert name: FKBP(III)-GBPen
• Alt name: FKBP-FKBP-FKBP-GBPen
• Alt name: 4XFKBP Dongle
• Species: Synthetic
• Insert Size (bp): 1365
• Promoter: IRES

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: Bgl II (not destroyed)
• 5′ sequencing primer: -
• 3′ sequencing primer: TTTAAAGCAAGTAAAACCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Gene synthesis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry