Skip to main content
Addgene

pMRX-INU-FLAG-RTN3L
(Plasmid #128264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128264 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMRX-INU-FLAG
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6391
  • Total vector size (bp) 9490
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RTN3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3099
  • GenBank ID
    NP_00125218.1
  • Entrez Gene
    RTN3 (a.k.a. ASYIP, HAP, NSPL2, NSPLII, RTN3-A1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GGCATCGCAGCTTGGATACACGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-INU-FLAG-RTN3L was a gift from Noboru Mizushima (Addgene plasmid # 128264 ; http://n2t.net/addgene:128264 ; RRID:Addgene_128264)
  • For your References section:

    Intrinsically Disordered Protein TEX264 Mediates ER-phagy. Chino H, Hatta T, Natsume T, Mizushima N. Mol Cell. 2019 Apr 11. pii: S1097-2765(19)30257-6. doi: 10.1016/j.molcel.2019.03.033. 10.1016/j.molcel.2019.03.033 PubMed 31006538