pMRX-INU-FLAG-FAM134Bs
(Plasmid #128261)

• Purpose: Expresses FAM134Bs in mammalian cells
• Depositing Lab: Noboru Mizushima
• Publication: Chino et al Mol Cell. 2019 Apr 11. pii: S1097-2765(19)30257-6. doi: 10.1016/j.molcel.2019.03.033.

Backbone

• Vector backbone: pMRX-INU-FLAG
• Backbone manufacturer: Dr.Shoji Yamaoka of Tokyo Medical and Dental University
• Backbone size w/o insert (bp): 6404
• Total vector size (bp): 7472
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FAM134Bs
• Species: H. sapiens (human)
• Insert Size (bp): 1068
• GenBank ID: NP_061873.2
• Entrez Gene: RETREG1 (a.k.a. FAM134B, JK-1, JK1)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGCATCGCAGCTTGGATACACGCC

Resource Information

• Supplemental Documents:
  • pMRX-INU-FAM134Bs-3xFLAG.gbk
• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry