pKF-D2irTNP2AG-T2APuroR-5kwh
(Plasmid #128255)

• Purpose: Mammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.
• Depositing Lab: Gabor Balazsi
• Publication: Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w.

Backbone

• Vector backbone: pDN-D2irTN2aG5kwh
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 7547
• Total vector size (bp): 8198
• Modifications to backbone: Replaced hTetR::P2A::EGFP in the backbone with the insert.
• Vector type: Mammalian Expression, Synthetic Biology ; Flp-In expression vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTetR::P2A::EGFP::T2A::PuroR
• Alt name: Humanized Tetracycline Repressor
• Alt name: EGFP
• Alt name: PuroR
• Species: Synthetic
• Insert Size (bp): 2096
• Promoter: CMV-D2ir promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACGGGCCAGATATACGCGTT
• 3′ sequencing primer: GCGGCCGCACCGGTTCAGGCACCGGGCTTGCG

Resource Information

• Supplemental Documents:
  • pKF-D2irTNP2AG-T2APuroR-5kwh.gb
• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid encodes a synthetic gene circuit controlling the PuroR gene using negative feedback through a humanized tetracycline repressor (hTetR) self-repressing a CMV-derived promoter with 2 tetO2 sites (CMV-D2ir). The circuit is also called mNF-PuroR.