pDN-D2irTN2AG5kwh
(Plasmid #128253)

• Purpose: Mammalian linearizer gene circuit in a Flp-In expression system based on negative feedback. The hTetR and EGFP is separated by a P2A motif.
• Depositing Lab: Gabor Balazsi
• Publication: Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w.

Backbone

• Vector backbone: pDN-D2irTNG5kwh
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 7505
• Total vector size (bp): 7547
• Vector type: Mammalian Expression, Synthetic Biology ; Flp-In expression vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Beta Globin Intron::hTetR::P2A::EGFP
• Alt name: Beta Globin Intron
• Alt name: Humanized Tetracycline Repressor
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 2817
• Promoter: CMV D2ir promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACGGGCCAGATATACGCGTT
• 3′ sequencing primer: CCATAGAGCCCACCGCATCCC

Resource Information

• Supplemental Documents:
  • pDN-D2irTN2AG5kwh.gb
• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid encodes a mammalian synthetic gene circuit with the humanized Tetracycline Repressor (hTetR) regulator separated from EGFP by a P2A motif, which is controlled by a CMV-derived promoter containing 2 tetO2 sites. With hTetR binding to the promoter, negative feedback lowers gene expression noise while linearizing the mean dose response. The circuit is also called mNF-GFP and is within a Flp-In expression vector.