Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMC051-HisMS2_PLP_pac_LC
(Plasmid #128234)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128234 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pMX
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 2200
  • Total vector size (bp) 4630
  • Modifications to backbone
    A->G mutation in the origin of replication
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Maturation Protein
  • Alt name
    A-Protein
  • Species
    MS2 Phage
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATGTGCTGCAAGGCGATTAAGTTG
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Coat Protein Dimer
  • Species
    Synthetic
  • Insert Size (bp)
    801
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATGTGCTGCAAGGCGATTAAGTTG
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMC051-HisMS2_PLP_pac_LC was a gift from Paul Freemont (Addgene plasmid # 128234 ; http://n2t.net/addgene:128234 ; RRID:Addgene_128234)
  • For your References section:

    Bacteriophage MS2 displays unreported capsid variability assembling T = 4 and mixed capsids. de Martin Garrido N, Crone MA, Ramlaul K, Simpson PA, Freemont PS, Aylett CHS. Mol Microbiol. 2019 Oct 16. doi: 10.1111/mmi.14406. 10.1111/mmi.14406 PubMed 31618483