NM1-5S-tRNA-SgH
(Plasmid #128178)

• Purpose: Expresses gRNA using fusion of R. toruloides 5S rRNA and tRNA-Arg as promoter
• Depositing Lab: Huimin Zhao
• Publication: Schultz et al Biotechnol Bioeng. 2019 Apr 30. doi: 10.1002/bit.27001.

Backbone

• Vector backbone: pZPK
• Backbone size w/o insert (bp): 6303
• Total vector size (bp): 9317
• Modifications to backbone: R. toruloides hygromycin resistance gene added between LB and RB. R. toruloides 5S rRNA-tRNA(Arg) promoter and polyT terminator added between LB and hygromycin resistance gene.
• Vector type: Yeast Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNA cloning cassette
• gRNA/shRNA sequence: gRNA cloning cassette
• Species: Rhodosporidium toruloides
• Promoter: 5S rRNA-tRNA(Arg)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: CAAATTGACGCTTAGACAAC
• 3′ sequencing primer: TATATCCTGTCAAACACTGATAG

Resource Information

• Supplemental Documents:
  • nm1-5s-trna-sgh.gb
• A portion of this plasmid was derived from a plasmid made by: 5S-tRNA cassette synthesized by Genscript. hygR gene received from Professor Zongbao K. Zhao.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry