pTRIPZ shcGAS-Hsa
(Plasmid #128175)

• Purpose: Doxycyclin inducible shRNA knockdown of human cGAS gene
• Depositing Lab: Sandra Demaria
• Publication: Vanpouille-Box et al Nat Commun. 2017 Jun 9;8:15618. doi: 10.1038/ncomms15618.

Backbone

• Vector backbone: pTRIPZ RFP+
• Backbone size w/o insert (bp): 13320
• Total vector size (bp): 13412
• Modifications to backbone: insertion of human cGAS specific shRNA hairpin sequence between XhoI and Eco RI restriction sites
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: shcGAS Mmu
• Alt name: Mb21d1, E330016A19Rik
• gRNA/shRNA sequence: AAGGAAGGAAATGGTTTCCAAG
• Species: H. sapiens (human)
• GenBank ID: 115004
• Entrez Gene: CGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cagaaggctcgagaaggtatattgctgttgctgttgacagtgagcg
• 3′ sequencing primer: ctaaagtagccccttgaattccgaggcagtaggca

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry