pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid)
(Plasmid #128164)

• Purpose: UV5 promoter drives expression of Zif268-consensus peptide fusion. Pair with pGHUC w-ERBIN as a positive control (turns on HIS3/GFP).
• Depositing Lab: Marcus Noyes
• Publication: Ichikawa et al ACS Synth Biol. 2019 May 17;8(5):918-928. doi: 10.1021/acssynbio.8b00499. Epub 2019 Apr 18.

Backbone

• Vector backbone: pB1H2w2-zif268 (ColE1)
• Backbone size w/o insert (bp): 3695
• Total vector size (bp): 3747
• Modifications to backbone: Omega subunit of RNA polymerase removed from original vector. 10 amino acid glycine/serine linker followed by ERBIN PDZ consensus ligand sequence (WETWV) fused to c-terminus of zif268. UV2 promoter changed to UV5.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 10 amino acid glycine/serine linker + ERBIN PDZ consensus ligand (WETWV)
• Species: Synthetic
• Insert Size (bp): 52
• Promoter: UV5
• Tags / Fusion Proteins:
  • FLAG (N terminal on backbone)
  • zif268 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGCCAGGATCTTCAGCGGAG

Resource Information

• Supplemental Documents:
  • pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry