pCS2+mScarlet-C Cloning Vector
(Plasmid #128147)

• Purpose: (Empty Backbone) To express a protein of interest fused to the C-terminus of mScarlet
• Depositing Lab: Ken-Ichi Takemaru
• Publication: To express a protein of interest fused to the C-terminus of mScarlet (unpublished)

Backbone

• Vector backbone: pCS2+
• Vector type: Mammalian Expression
• Tag / Fusion Protein:
  • mScarlet fusion (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GCGTGCCTAATGGGAGGTCT (CSF)
• 3′ sequencing primer: CACTGCATTCTAGTTCTGGT (CSR)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry