-
Purpose(Empty Backbone) To express a protein of interest fused to the C-terminus of Flag-APEX2 for proximity labeling or TEM
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
-
Tag
/ Fusion Protein
- Flag-APEX2 (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (pCD-betaG-FLAG-R) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-APEX2-C Cloning Vector was a gift from Ken-Ichi Takemaru (Addgene plasmid # 128146 ; http://n2t.net/addgene:128146 ; RRID:Addgene_128146)
Map uploaded by the depositor.
