Skip to main content
Addgene

PX458-sgEIF4EBP1
(Plasmid #128097)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128097 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PX458 (pSpCas9(BB)-2A-GFP)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 9271
  • Total vector size (bp) 9291
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CRISPR sgRNA against human 4EBP1
  • Alt name
    Eukaryotic translation initiation factor 4E-binding protein 1
  • Alt name
    4E-BP1
  • Alt name
    4EBP1
  • gRNA/shRNA sequence
    TGAAGAGTCACAGTTTGAGA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_004095
  • Entrez Gene
    EIF4EBP1 (a.k.a. 4E-BP1, 4EBP1, BP-1, PHAS-I)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6-Fwd primer (GAGGGCCTATTTCCCATGATTCC)
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GeCKO sgRNA library (Shalem et al., 2014) and PX458 (pSpCas9(BB)-2A-GFP, Feng Zhang, Addgene plasmid #48138)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-sgEIF4EBP1 was a gift from Chi Van Dang (Addgene plasmid # 128097 ; http://n2t.net/addgene:128097 ; RRID:Addgene_128097)

  • For your References section:

    Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175
Related items:
Commonly requested with: