Skip to main content
Addgene

pGL4.22-PGK1-HRE::dLUC
(Plasmid #128095)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128095 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL4.22
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5566
  • Total vector size (bp) 5647
  • Modifications to backbone
    insertion of the PGK1 HRE (x3) into promoter region
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The depositing lab used Top10 in their studies.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hypoxia response element (x3) from PGK1 promoter
  • Alt name
    HRE (x3)
  • Alt name
    HIF response element (x3)
  • Alt name
    phosphoglycerate kinase 1 hypoxia response element (x3)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    79
  • GenBank ID
    NM_000291
  • Entrez Gene
    PGK1 (a.k.a. HEL-S-68p, MIG10, PGKA)
  • Promoter inserted PGK1 hypoxia response elements (HRE) (x3)
  • Tag / Fusion Protein
    • drives expression of destabilized luciferase (2CP) for real-time HRE activity assessment (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer RVprimer3: CTAGCAAAATAGGCTGTCCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    HRE-pGL2-TK (Li et al., 2014; Celeste Simon Lab) and pGL4.22 (Promega)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.22-PGK1-HRE::dLUC was a gift from Chi Van Dang (Addgene plasmid # 128095 ; http://n2t.net/addgene:128095 ; RRID:Addgene_128095)

  • For your References section:

    Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175
Related items:
Commonly requested with: