pAC1749
(Plasmid #127983)

• Purpose: AMA1 plasmid with Aspergillus optimized Cpf1, hygB selection marker, and USER cassette (PacI/Nt.BbvCI)
• Depositing Lab: Uffe Mortensen
• Publication: Vanegas et al Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019.

Backbone

• Vector backbone: pAC574
• Backbone size w/o insert (bp): 10046
• Total vector size (bp): 15303
• Vector type: Bacterial Expression, CRISPR ; Fungal Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cpf1
• Alt name: Lb_Cpf1 ; Cas12a
• Species: Synthetic; Lachnospiraceae bacterium
• Insert Size (bp): 3846
• Mutation: codon optimized for Aspergillus nidulans
• Promoter: Aspergillus nidulans tef1 promoter
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTTCTCTGCTCAGCACCTCTACG
• 3′ sequencing primer: GCTTTACGGGAAGAGCTGAGAT

Resource Information

• Supplemental Documents:
  • pAC1749.gbk
• A portion of this plasmid was derived from a plasmid made by: The cpf1 gene contained in the vector is custom made version that we bought from Thermo Fisher Scientific.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AMA1 sequence contains multiple ambiguous bases that are likely mixed nucleotide populations. AMA1 is a palindrome and thus difficult to sequence. Dep. confirms the mixed population does not affect plasmid function.