pAC575
(Plasmid #127976)

• Purpose: AMA1 plasmid with ble selection marker, and USER cassette (PacI/Nt.BbvCI)
• Depositing Lab: Uffe Mortensen
• Publication: Vanegas et al Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019.

Backbone

• Vector backbone: custom
• Total vector size (bp): 10152
• Modifications to backbone: AMA1 element
• Vector type: Bacterial Expression ; Fungal Expression
• Selectable markers: Zeocin ; Bleomycin ; Phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ble (bleomycin resistance marker)
• Species: Streptoalloteichus hindustanus
• Insert Size (bp): 375
• Promoter: Aspergillus nidulans trpC promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GATCTCATGGTCATAGCTGTTTCC
• 3′ sequencing primer: GTGTCGCCCTTATTCGACTCA

Resource Information

• Supplemental Documents:
  • pAC575.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AMA1 sequence contains multiple ambiguous bases that are likely mixed nucleotide populations. AMA1 is a palindrome and thus difficult to sequence. Dep. confirms the mixed population does not affect plasmid function.