pAC573
(Plasmid #127974)

• Purpose: AMA1 plasmid with argB selection marker, and USER cassette (PacI/Nt.BbvCI)
• Depositing Lab: Uffe Mortensen
• Publication: Vanegas et al Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019.

Backbone

• Vector backbone: custom
• Total vector size (bp): 10868
• Modifications to backbone: AMA1 element
• Vector type: Bacterial Expression ; Fungal Expression
• Selectable markers: argB

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: argB
• Species: Aspergillus nidulans
• Insert Size (bp): 1192
• Promoter: native promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GATCTCATGGTCATAGCTGTTTCC
• 3′ sequencing primer: GTGTCGCCCTTATTCGACTCA

Resource Information

• Supplemental Documents:
  • pAC573.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AMA1 is a palindrome which causes issues sequencing. There are a few nucleotides with a mixed population. This however does not affect plasmid function.

Published in: Nødvig CS, Hoof JB, Kogle ME, Jarczynska ZD, Lehmbeck J, Klitgaard DK, et al. Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli. Fungal Genet Biol. 2018;115:78–89, https://doi.org/10.1016/j.fgb.2018.01.004.