-
PurposeExpresses the iGlucoSnFR-TS biosensor for intracellular [glucose], with a fluorescence-lifetime readout, in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV.CAG...WPRE.SV40pA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiGlucoSnFR-TS
-
Alt nameSweetieTS
-
SpeciesSynthetic
-
Insert Size (bp)2040
- Promoter CAG
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- Xpress epitope (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Commercial use is protected by US Patent 9939437
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-iGlucoSnFR-TS was a gift from Gary Yellen (Addgene plasmid # 127952 ; http://n2t.net/addgene:127952 ; RRID:Addgene_127952) -
For your References section:
Quantitative in vivo imaging of neuronal glucose concentrations with a genetically encoded fluorescence lifetime sensor. Diaz-Garcia CM, Lahmann C, Martinez-Francois JR, Li B, Koveal D, Nathwani N, Rahman M, Keller JP, Marvin JS, Looger LL, Yellen G. J Neurosci Res. 2019 May 20. doi: 10.1002/jnr.24433. 10.1002/jnr.24433 PubMed 31106909