-
PurposeExpresses the iGlucoSnFR-TS biosensor for intracellular [glucose], with a fluorescence-lifetime readout, in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV.CAG...WPRE.SV40pA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiGlucoSnFR-TS
-
Alt nameSweetieTS
-
SpeciesSynthetic
-
Insert Size (bp)2040
- Promoter CAG
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- Xpress epitope (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Commercial use is protected by US Patent 9939437
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-iGlucoSnFR-TS was a gift from Gary Yellen (Addgene plasmid # 127952 ; http://n2t.net/addgene:127952 ; RRID:Addgene_127952) -
For your References section:
Quantitative in vivo imaging of neuronal glucose concentrations with a genetically encoded fluorescence lifetime sensor. Diaz-Garcia CM, Lahmann C, Martinez-Francois JR, Li B, Koveal D, Nathwani N, Rahman M, Keller JP, Marvin JS, Looger LL, Yellen G. J Neurosci Res. 2019 May 20. doi: 10.1002/jnr.24433. 10.1002/jnr.24433 PubMed 31106909