pX330 Human 3' HP1a gRNA
(Plasmid #127907)

• Purpose: WT Cas9 Vector targeting the 3' end of the human HP1a gene
• Depositing Lab: Mark Groudine
• Publication: Strom et al Elife. 2021 Jun 9;10. pii: 63972. doi: 10.7554/eLife.63972.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNA for Human 3' HP1a
• gRNA/shRNA sequence: acagcaaagagctaaaggag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: cacctctgacttgagcgtcg

Resource Information

• Supplemental Documents:
  • pX330_Human_HP1a_gRNA.gbk
• A portion of this plasmid was derived from a plasmid made by: https://www.addgene.org/42230/
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry