pX335 Mouse 5' Srcap gRNA A
(Plasmid
#127904)
-
PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
-
Modifications to backbonegRNA inserted
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSrcap gRNA
-
gRNA/shRNA sequencegctcccaatcctacagacac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer cacctctgacttgagcgtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX335 Mouse 5' Srcap gRNA A was a gift from Mark Groudine (Addgene plasmid # 127904 ; http://n2t.net/addgene:127904 ; RRID:Addgene_127904)