Mouse 5' Srcap AID GFP Puro
(Plasmid #127903)

• Purpose: HDR (donor) Plasmid for Inserting PuroR-2A-GFP-AID into the 5' end of the Mouse Srcap Gene
• Depositing Lab: Mark Groudine
• Publication: Plasmids for generating AID/Degron Cell Lines in Human and Mouse (unpublished)

Backbone

• Vector backbone: pBSk
• Vector type: Donor plasmid
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Srcap
• Alt name: Snf2-related CREBBP activator protein
• Species: M. musculus (mouse), A. thaliana (mustard weed)
• Insert Size (bp): 2094
• GenBank ID: NC_000073.6
• Entrez Gene: Srcap (a.k.a. B930091H02Rik, D030022P06Rik, F630004O05Rik)
• Tag / Fusion Protein:
  • GFP, AID, PuroR

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagggttattgtctcatgagcgg

Resource Information

• Supplemental Documents:
  • Mouse 5' Srcap Puro 2a GFP AID KI.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry