pX330 Mouse 3' Ubf gRNA
(Plasmid
#127902)
-
PurposeWT Cas9 Vector targeting the 3' end of the mouse Ubf gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Modifications to backbonegRNA to Ubf
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA for Mouse 3' Ubf
-
gRNA/shRNA sequencetcggattctgactccaactg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer cacctctgacttgagcgtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/42230/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330 Mouse 3' Ubf gRNA was a gift from Mark Groudine (Addgene plasmid # 127902 ; http://n2t.net/addgene:127902 ; RRID:Addgene_127902)