-
PurposeDual expression vector for mitochondrial matrix and outer membrane Ca2+ sensors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5398
- Total vector size (bp) 8662
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOuter membrane localized jRCaMP1b - P2A - mito4xGCaMP6f
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-OMMjRCaMP-P2A-mito4xGCaMP6f was a gift from Timothy Ryan (Addgene plasmid # 127872 ; http://n2t.net/addgene:127872 ; RRID:Addgene_127872) -
For your References section:
Molecular Tuning of the Axonal Mitochondrial Ca(2+) Uniporter Ensures Metabolic Flexibility of Neurotransmission. Ashrafi G, de Juan-Sanz J, Farrell RJ, Ryan TA. Neuron. 2019 Dec 10. pii: S0896-6273(19)30984-5. doi: 10.1016/j.neuron.2019.11.020. 10.1016/j.neuron.2019.11.020 PubMed 31862210