pAAV-hSyn-mCherry.3xFLAG.NOS1AP-WPRE
(Plasmid #127864)

• Purpose: pAAV plasmid expressing an mCherry.3xFLAG.NOS1AP fusion protein under the hSyn promoter
• Depositing Lab: Florian Freudenberg
• Publication: Candemir et al Eur Neuropsychopharmacol. 2016 Apr;26(4):741-55. doi: 10.1016/j.euroneuro.2016.01.008. Epub 2016 Jan 28.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5340
• Total vector size (bp): 6855
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nos1ap
• Alt name: CAPON
• Species: M. musculus (mouse)
• Insert Size (bp): 1515
• GenBank ID: NM_001109985
• Entrez Gene: Nos1ap (a.k.a. 6330408P19Rik, Capon)
• Promoter: hSyn
• Tags / Fusion Proteins:
  • mCherry (N terminal on backbone)
  • 3xFLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976). mCherry was amplified by PCR from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry