Skip to main content
Addgene

pAAV-hSyn-mCherry.3xFLAG-WPRE
(Plasmid #127861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127861 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4638
  • Total vector size (bp) 5343
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Discosoma
  • Insert Size (bp)
    705
  • Promoter hSyn
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cactgccagcttcagcac
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976). mCherry was amplified by PCR from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-mCherry.3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 127861 ; http://n2t.net/addgene:127861 ; RRID:Addgene_127861)
  • For your References section:

    Interaction of NOS1AP with the NOS-I PDZ domain: Implications for schizophrenia-related alterations in dendritic morphology. Candemir E, Kollert L, Weissflog L, Geis M, Muller A, Post AM, O'Leary A, Harro J, Reif A, Freudenberg F. Eur Neuropsychopharmacol. 2016 Apr;26(4):741-55. doi: 10.1016/j.euroneuro.2016.01.008. Epub 2016 Jan 28. 10.1016/j.euroneuro.2016.01.008 PubMed 26861996