pACYC-TtCas6-4xcrRNA4.5
(Plasmid #127764)

• Purpose: For expression of T. thermophilus Csm complex in E. coli (crRNA)
• Depositing Lab: Jennifer Doudna
• Publication: Liu et al Nat Commun. 2019 Jul 5;10(1):3001. doi: 10.1038/s41467-019-10780-2.

Backbone

• Vector backbone: pACYCDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3920
• Total vector size (bp): 4977
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Synthetic CRISPR array containing four identical T. thermophilus spacers
• Species: Synthetic; Thermus thermophilus HB8
• Insert Size (bp): 340
• GenBank ID: AP008227.1 (144467 to 144542)
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: N/A
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: Cas6A
• Alt name: TTHA0078
• Alt name: Cas6 endonuclease
• Species: Synthetic; Thermus thermophilus HB8
• Insert Size (bp): 4977
• Mutation: Codon optimized for expression in E. coli
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: N/A
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry