-
Purpose(Empty Backbone) Used for expression of sgRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988)
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AGCTGGGAGGCGACAAAAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSpCas9(BB)-2A-Puro (PX459) V2.0 was digested with EcoRI to remove the T2A-Puro cassette, and a P2A-Hygromycin cassette was amplified by PCR, digested with MfeI, and ligated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Hygro was a gift from Ken-Ichi Takemaru (Addgene plasmid # 127763 ; http://n2t.net/addgene:127763 ; RRID:Addgene_127763)