Skip to main content
Addgene

pY128
(Plasmid #127713)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127713 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEMY11
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    G418

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GTTATCCCCTGATTCTGTGG
  • 3′ sequencing primer ATTCAGCAATTTGCCCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

High copy yeast shuttle vector compatible with TypeIIS assembly (GoldenGate or MoClo). A scar is GTGC and D scar is CCTC. LacZ cassette for blue/white screening of clones.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pY128 was a gift from Christopher Voigt (Addgene plasmid # 127713 ; http://n2t.net/addgene:127713 ; RRID:Addgene_127713)

  • For your References section:

    Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070
Related items:
Commonly requested with: