Skip to main content
Addgene

pJH-MBP-CbAgo
(Plasmid #127707)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET (Plasmid #29656)
  • Backbone manufacturer
    Scott Gradia
  • Backbone size w/o insert (bp) 6472
  • Total vector size (bp) 8716
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CbAgo
  • Species
    Clostridium butyricum
  • Insert Size (bp)
    2244
  • Promoter T7
  • Tag / Fusion Protein
    • MPB (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH-MBP-CbAgo was a gift from John van der Oost (Addgene plasmid # 127707 ; http://n2t.net/addgene:127707 ; RRID:Addgene_127707)
  • For your References section:

    DNA-guided DNA cleavage at moderate temperatures by Clostridium butyricum Argonaute. Hegge JW, Swarts DC, Chandradoss SD, Cui TJ, Kneppers J, Jinek M, Joo C, van der Oost J. Nucleic Acids Res. 2019 May 9. pii: 5487266. doi: 10.1093/nar/gkz306. 10.1093/nar/gkz306 PubMed 31069393