Skip to main content
Addgene

Sender plasmid
(Plasmid #127677)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127677 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 5986
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LuxI
  • Species
    V. fischeri
  • Insert Size (bp)
    643
  • Promoter pT7
  • Tag / Fusion Protein
    • LVA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTGATGTCGGCGATATAGG
  • 3′ sequencing primer GTTAATTAAGCTGCGCTAGTAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmids were first used in the publication of Weitz et al. J. Am. Chem. Soc., 2014, 136, 72–75.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert was cloned by A. Mückl.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sender plasmid was a gift from Friedrich Simmel (Addgene plasmid # 127677 ; http://n2t.net/addgene:127677 ; RRID:Addgene_127677)

  • For your References section:

    Chemical communication between bacteria and cell-free gene expression systems within linear chains of emulsion droplets. Schwarz-Schilling M, Aufinger L, Muckl A, Simmel FC. Integr Biol (Camb). 2016 Apr 18;8(4):564-70. doi: 10.1039/c5ib00301f. Epub 2016 Jan 18. 10.1039/c5ib00301f PubMed 26778746
Related items:
Commonly requested with: