"AND-gate" receiver plasmid
(Plasmid #127676)

• Purpose: Encodes the transcriptional activator LuxR and GFP. LuxR has an pLlacO-1 promoter and the GFP has a pLux promoter.
• Depositing Lab: Friedrich Simmel
• Publication: Schwarz-Schilling et al Integr Biol (Camb). 2016 Apr 18;8(4):564-70. doi: 10.1039/c5ib00301f. Epub 2016 Jan 18.

Backbone

• Vector backbone: pSB1A3
• Backbone size w/o insert (bp): 2100
• Total vector size (bp): 3964
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LuxR, GFP
• Species: Synthetic; Aliivibrio fischeri
• Insert Size (bp): 1900
• Promoter: pLlacO-1 for LuxR, pLux for GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: TGCCACCTGACGTCTAAGAA
• 3′ sequencing primer: ATTACCGCCTTTGAGTGAGC

Resource Information

• Supplemental Documents:
  • and-gate-plasmid.gb
• A portion of this plasmid was derived from a plasmid made by: The plasmids were first used in the publication of Weitz et al. J. Am. Chem. Soc., 2014, 136, 72–75.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert was cloned by A. Mückl.