LADL Bridge + Promoter Only Target
(Plasmid #127669)

• Purpose: Encodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promoters
• Depositing Lab: Jennifer Phillips-Cremins
• Publication: Kim et al Nat Methods. 2019 Jun 24. pii: 10.1038/s41592-019-0436-5. doi: 10.1038/s41592-019-0436-5.

Backbone

• Vector backbone: Derived from pUC19
• Backbone manufacturer: Cremins lab
• Backbone size w/o insert (bp): 4437
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRY2-HA-2A-mCherry and gRNAs 115 and 117
• gRNA/shRNA sequence: TAAAGAAAAGTGTTTATCGA, AAGTGTTTATCGAGGGAAAG
• Species: Synthetic
• Insert Size (bp): 4194
• Promoter: EF1a and hU6
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: EF-1a Forward
• 3′ sequencing primer: BGH Reverse

Resource Information

• Supplemental Documents:
  • 13_ladl-bridge-promoter-only-target.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry