Skip to main content
Addgene

gRNA-NONO-1
(Plasmid #127654)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127654 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    gRNA_Cloning Vector
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NONO sgRNA
  • gRNA/shRNA sequence
    GGCAATCTCCGCTAGGGTTC
  • Species
    H. sapiens (human)
  • Entrez Gene
    NONO (a.k.a. MRXS34, NMT55, NRB54, P54, P54NRB, PPP1R114)

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA-NONO-1 was a gift from Nicolas Manel (Addgene plasmid # 127654 ; http://n2t.net/addgene:127654 ; RRID:Addgene_127654)

  • For your References section:

    NONO Detects the Nuclear HIV Capsid to Promote cGAS-Mediated Innate Immune Activation. Lahaye X, Gentili M, Silvin A, Conrad C, Picard L, Jouve M, Zueva E, Maurin M, Nadalin F, Knott GJ, Zhao B, Du F, Rio M, Amiel J, Fox AH, Li P, Etienne L, Bond CS, Colleaux L, Manel N. Cell. 2018 Oct 4;175(2):488-501.e22. doi: 10.1016/j.cell.2018.08.062. Epub 2018 Sep 27. 10.1016/j.cell.2018.08.062 PubMed 30270045
Related items: