-
PurposeKnock-out of human STING
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPRv2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTING
-
gRNA/shRNA sequenceAGGTACCGGAGAGTGTGCTC
-
SpeciesH. sapiens (human)
-
Entrez GeneSTING1 (a.k.a. ERIS, MITA, MPYS, NET23, SAVI, STING, STING-beta, TMEM173, hMITA, hSTING)
Cloning Information
- Cloning method Unknown
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-STING_gRNA3 was a gift from Nicolas Manel (Addgene plasmid # 127640 ; http://n2t.net/addgene:127640 ; RRID:Addgene_127640) -
For your References section:
Intrinsic antiproliferative activity of the innate sensor STING in T lymphocytes. Cerboni S, Jeremiah N, Gentili M, Gehrmann U, Conrad C, Stolzenberg MC, Picard C, Neven B, Fischer A, Amigorena S, Rieux-Laucat F, Manel N. J Exp Med. 2017 Jun 5;214(6):1769-1785. doi: 10.1084/jem.20161674. Epub 2017 May 8. 10.1084/jem.20161674 PubMed 28484079