SV40-eGFP-Z1
(Plasmid
#127638)
-
PurposeMinimal backbone plasmid for mammalian eGFP expression from SV40 promoter with zeocin/bleocin bacterial resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMB1 zeocin
- Backbone size w/o insert (bp) 1933
- Total vector size (bp) 2649
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Alt nameenhanced green fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TATTTATGCAGAGGCCGAGG
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SV40-eGFP-Z1 was a gift from Jordan Green (Addgene plasmid # 127638 ; http://n2t.net/addgene:127638 ; RRID:Addgene_127638)
Map uploaded by the depositor.
