Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSB1C3_YPet-PCP (y-plasmid)
(Plasmid #127637)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127637 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB1C3
  • Backbone size w/o insert (bp) 2100
  • Total vector size (bp) 3488
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YPet
  • Alt name
    YFP
  • Alt name
    fluorescent recombinant protein
  • Species
    Synthetic
  • Insert Size (bp)
    1220
  • Promoter pJ21306
  • Tag / Fusion Protein
    • RNA binding peptide: PP7 coat protein (PCP) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert YPet-PCP was designed by G.Grossi and M. Schwarz-Schilling and cloned by A. Dupin and M. Schwarz-Schilling. YPet sequence is from Nguyen, A. W. and Daugherty, P. S. Nat. Biotechnol. 2005, 23, 355−360. PCP sequence is from Chao, J. A. et al. Nat. Struct. Mol. Biol. 2008, 15, 103−105. The peptide linker sequence between between YPet and PCP is TRGGGGS.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB1C3_YPet-PCP (y-plasmid) was a gift from Friedrich Simmel (Addgene plasmid # 127637 ; http://n2t.net/addgene:127637 ; RRID:Addgene_127637)
  • For your References section:

    Optimized Assembly of a Multifunctional RNA-Protein Nanostructure in a Cell-Free Gene Expression System. Schwarz-Schilling M, Dupin A, Chizzolini F, Krishnan S, Mansy SS, Simmel FC. Nano Lett. 2018 Apr 11;18(4):2650-2657. doi: 10.1021/acs.nanolett.8b00526. Epub 2018 Mar 27. 10.1021/acs.nanolett.8b00526 PubMed 29564885
Commonly requested with: