pSB4k5_RNAnano (r-plasmid)
(Plasmid #127634)

• Purpose: Encodes an RNA nanostructure with MG, PP7, TAR and S1m RNA aptamers. Transcription via T7 RNAP.
• Depositing Lab: Friedrich Simmel
• Publication: Schwarz-Schilling et al Nano Lett. 2018 Apr 11;18(4):2650-2657. doi: 10.1021/acs.nanolett.8b00526. Epub 2018 Mar 27.

Backbone

• Vector backbone: pSB4K5
• Backbone size w/o insert (bp): 3300
• Total vector size (bp): 3894
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RNA nanostrcutre
• Species: Synthetic
• Insert Size (bp): 450
• Promoter: T7 RNAP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: TGCCACCTGACGTCTAAGAA
• 3′ sequencing primer: ATTACCGCCTTTGAGTGAGC

Resource Information

• Supplemental Documents:
  • psb4k5_rnanano(1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert was designed by F. Chizzolini and M. Schwarz-Schilling and cloned by M.Schwarz-Schilling. The RNA sequence for the: 3WJ is from Shu, D. et al. Nucleic Acids Res. 2014, 42, e10; MG aptamer is from Babendure, J. R. et al. J. Am. Chem. Soc. 2003, 125, 14716−7; PP7 aptamer is from Chao, J. A. et al. Nat. Struct. Mol. Biol. 2008, 15, 103−5; TAR aptamer is from Bayer, T. S. et al. RNA 2005, 11, 1848−57; Streptavidin aptamer is from: Srisawat, C. and Engelke, D. R. RNA 2001, 7, 632−41.