Skip to main content
Addgene

pSLQ-mgU2-47-Mango II
(Plasmid #127586)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127586 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSLQ
  • Backbone size w/o insert (bp) 8205
  • Total vector size (bp) 8411
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mgU2-47 scaRNA with Mango II tag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    206
  • Promoter modified U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTCGGGTTTATTACAGGGACAG
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ-mgU2-47-Mango II was a gift from David Rueda (Addgene plasmid # 127586 ; http://n2t.net/addgene:127586 ; RRID:Addgene_127586)

  • For your References section:

    Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells. Autour A, C Y Jeng S, D Cawte A, Abdolahzadeh A, Galli A, Panchapakesan SSS, Rueda D, Ryckelynck M, Unrau PJ. Nat Commun. 2018 Feb 13;9(1):656. doi: 10.1038/s41467-018-02993-8. 10.1038/s41467-018-02993-8 [pii] PubMed 29440634
Related items:
Commonly requested with: