pES133
(Plasmid #127552)

• Purpose: Variant of pKD13. Lambda Red recombineering PCR template plasmid carrying an F5-tetA-F5 cassette orthogonal to FRT-KanR-FRT in pKD13
• Depositing Labs: Emmanuele Severi, Gavin Thomas
• Publication: Lambda Red recombineering PCR template plasmids, variants of pKD13 with orthogonal marker-FRT sites (unpublished)

Backbone

• Vector backbone: pKD13
• Backbone manufacturer: KEIO collection material
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 3522
• Modifications to backbone: None - except that the backbone was PCR-amplified and not re-squenced
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: The plasmid is stable and can be selected on sole ampiciliin
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: F5-flanked tetracycline resistance cassette
• Alt name: F5-tetA-F5
• Species: Synthetic; pBR322
• Insert Size (bp): 1400
• Mutation: Multiple SNPs in tetA (originally from pBR322) to suppress a number of restriction sites

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cctcgctttgtaacggagtagag
• 3′ sequencing primer: gacggatggcctttttgcgtggc

Resource Information

• Supplemental Documents:
  • pes133-pkd13f5-teta-f5.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry