MyoUTipGAPi
(Plasmid
#127549)
-
PurposePositive RNAi control for pGAPi-based RNAi silencing in tandem with APT transcript segment
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGAPi
-
Backbone manufacturerVidali Lab
- Backbone size w/o insert (bp) 6647
- Total vector size (bp) 9575
-
Vector typeRNAi ; Positive control
-
Selectable markersHygromycin ; 2-Fluoroadenine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyosin XIa+b 5'UTR and Adenine Phosphorybosyltransferase transcript segment
-
Alt nameMyoUTi-APT
-
Alt nameMyoUTi-APRT
-
SpeciesPhyscomitrella patens
-
Insert Size (bp)829
-
GenBank IDHM038541.1 HM038542.1
- Promoter Ubiquitin
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTTTTGTCGATGCTCACCCTG
- 3′ sequencing primer CCGGCAACAGGATTCAATCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MyoUTipGAPi was a gift from Luis Vidali (Addgene plasmid # 127549 ; http://n2t.net/addgene:127549 ; RRID:Addgene_127549) -
For your References section:
Robust survival-based RNAi of gene families using in tandem silencing of adenine phosphoribosyltransferase. Orr RG, Foley SJ, Sherman CA, Abreu I, Galotto G, Liu B, Gonzalez-Guerrero M, Vidali L. Plant Physiol. 2020 Aug 6. pii: pp.20.00865. doi: 10.1104/pp.20.00865. 10.1104/pp.20.00865 PubMed 32764132