Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAPi
(Plasmid #127548)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127548 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGAPi
  • Backbone manufacturer
    Vidali Lab
  • Backbone size w/o insert (bp) 6647
  • Total vector size (bp) 7827
  • Vector type
    RNAi ; Empty control
  • Selectable markers
    Hygromycin ; 2-Fluoroadenine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Adenine Phosphorybosyltransferase transcript segment
  • Alt name
    APT
  • Alt name
    APRT
  • Species
    Physcomitrella patens
  • Insert Size (bp)
    389
  • Promoter Ubiquitin

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTTTTGTCGATGCTCACCCTG
  • 3′ sequencing primer CCGGCAACAGGATTCAATCTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAPi was a gift from Luis Vidali (Addgene plasmid # 127548 ; http://n2t.net/addgene:127548 ; RRID:Addgene_127548)
  • For your References section:

    Robust survival-based RNAi of gene families using in tandem silencing of adenine phosphoribosyltransferase. Orr RG, Foley SJ, Sherman CA, Abreu I, Galotto G, Liu B, Gonzalez-Guerrero M, Vidali L. Plant Physiol. 2020 Aug 6. pii: pp.20.00865. doi: 10.1104/pp.20.00865. 10.1104/pp.20.00865 PubMed 32764132
Commonly requested with: