pcDNA3.1/NDUFS2 T58A/myc-His
(Plasmid
#127498)
-
PurposeExpresses myc-tagged NDUFS2/T58A in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1/myc-His(-)A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5500
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNDUFS2 T58A
-
Alt nameNADH:ubiquinone oxidoreductase core subunit S2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1392
-
MutationNDUFS2 T58A
-
Entrez GeneNDUFS2 (a.k.a. CI-49, MC1DN6)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gctgttatgtacccaagcaaagaagccgcccactggaagcctcc
- 3′ sequencing primer ggaggcttccagtgggcggcttctttgcttgggtacataacagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/NDUFS2 T58A/myc-His was a gift from Shashi Jain & Dieter Wolf (Addgene plasmid # 127498 ; http://n2t.net/addgene:127498 ; RRID:Addgene_127498) -
For your References section:
Metabolic targeting of cancer by a ubiquinone uncompetitive inhibitor of mitochondrial complex I. Jain S, Hu C, Kluza J, Ke W, Tian G, Giurgiu M, Bleilevens A, Campos AR, Charbono A, Stickeler E, Maurer J, Holinski-Feder E, Vaisburg A, Bureik M, Luo G, Marchetti P, Cheng Y, Wolf DA. Cell Chem Biol. 2021 Nov 23. pii: S2451-9456(21)00479-7. doi: 10.1016/j.chembiol.2021.11.002. 10.1016/j.chembiol.2021.11.002 PubMed 34852219