Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1/NDUFS2 T58A/myc-His
(Plasmid #127498)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127498 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1/myc-His(-)A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NDUFS2 T58A
  • Alt name
    NADH:ubiquinone oxidoreductase core subunit S2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1392
  • Mutation
    NDUFS2 T58A
  • Entrez Gene
    NDUFS2 (a.k.a. CI-49, MC1DN6)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer gctgttatgtacccaagcaaagaagccgcccactggaagcctcc
  • 3′ sequencing primer ggaggcttccagtgggcggcttctttgcttgggtacataacagc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/NDUFS2 T58A/myc-His was a gift from Shashi Jain & Dieter Wolf (Addgene plasmid # 127498 ; http://n2t.net/addgene:127498 ; RRID:Addgene_127498)
  • For your References section:

    Metabolic targeting of cancer by a ubiquinone uncompetitive inhibitor of mitochondrial complex I. Jain S, Hu C, Kluza J, Ke W, Tian G, Giurgiu M, Bleilevens A, Campos AR, Charbono A, Stickeler E, Maurer J, Holinski-Feder E, Vaisburg A, Bureik M, Luo G, Marchetti P, Cheng Y, Wolf DA. Cell Chem Biol. 2021 Nov 23. pii: S2451-9456(21)00479-7. doi: 10.1016/j.chembiol.2021.11.002. 10.1016/j.chembiol.2021.11.002 PubMed 34852219