Skip to main content
Addgene

pcDNA3.1/NDUFS2 _2-33/myc-His
(Plasmid #127492)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127492 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1/myc-His(-)A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NDUFS2 _2-33
  • Alt name
    NADH:ubiquinone oxidoreductase core subunit S2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1296
  • Mutation
    NDUFS2 _2-33
  • Entrez Gene
    NDUFS2 (a.k.a. CI-49, MC1DN6)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer gttcggcagtggcagccagatgtggaatgg
  • 3′ sequencing primer catcttagctagcagcttgggtctccctatagtgagtcgtat
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/NDUFS2 _2-33/myc-His was a gift from Shashi Jain & Dieter Wolf (Addgene plasmid # 127492 ; http://n2t.net/addgene:127492 ; RRID:Addgene_127492)
  • For your References section:

    Metabolic targeting of cancer by a ubiquinone uncompetitive inhibitor of mitochondrial complex I. Jain S, Hu C, Kluza J, Ke W, Tian G, Giurgiu M, Bleilevens A, Campos AR, Charbono A, Stickeler E, Maurer J, Holinski-Feder E, Vaisburg A, Bureik M, Luo G, Marchetti P, Cheng Y, Wolf DA. Cell Chem Biol. 2021 Nov 23. pii: S2451-9456(21)00479-7. doi: 10.1016/j.chembiol.2021.11.002. 10.1016/j.chembiol.2021.11.002 PubMed 34852219