Skip to main content
Addgene

pAVA-Gal11p-LGF2(fs)
(Plasmid #127482)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127482 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBT
  • Backbone manufacturer
    Agilent #240067
  • Modifications to backbone
    inserted AD domain of pTRG (Agilent #240066) adjacent but convergent to the DBD
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The Malek lab recommends using BacterioMatch II Validation Reporter Competent Cells (Catalog #200192) for downstream applications.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gal11p-LGF2(frame shifted)
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    420
  • Mutation
    LGF2 is frame shifted by the insert of one nucleotide between LGF2 and RNAp
  • Entrez Gene
    GAL11 (a.k.a. YOL051W, ABE1, MED15, RAR3, SDS4, SPT13)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site BstX1 (not destroyed)
  • 5′ sequencing primer TCCGTTGTGGGGAAAGTTATC
  • 3′ sequencing primer AGCTTCCAGTTGTTCAGCCA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAVA-Gal11p-LGF2(fs) was a gift from Joel Malek (Addgene plasmid # 127482 ; http://n2t.net/addgene:127482 ; RRID:Addgene_127482)

  • For your References section:

    High-resolution protein-protein interaction mapping using all-versus-all sequencing (AVA-Seq). Andrews SS, Schaefer-Ramadan S, Al-Thani NM, Ahmed I, Mohamoud YA, Malek JA. J Biol Chem. 2019 Jul 26;294(30):11549-11558. doi: 10.1074/jbc.RA119.008792. Epub 2019 Jun 10. 10.1074/jbc.RA119.008792 PubMed 31182485
Related items:
Commonly requested with: