pTOX5
(Plasmid #127450)

• Purpose: Encodes MqsR toxin and amilCP chromoprotein. CAM-R
• Depositing Lab: Matthew Waldor
• Publication: Lazarus et al Appl Environ Microbiol. 2019 Jun 14. pii: AEM.00990-19. doi: 10.1128/AEM.00990-19.

Backbone

• Vector backbone: pDS132
• Total vector size (bp): 6640
• Modifications to backbone: Extensive - see paper for details
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: NEEDS 2% GLUCOSE
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: mqsR toxin
• Promoter: pRha

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcatctttccctggttgcca
• 3′ sequencing primer: tcaaacatgagaattcgcgga

Gene/Insert 2

• Gene/Insert name: amilCP chromoprotein
• Mutation: Codon optimized from protein sequence in FPbase
• Promoter: tac

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atgtgtggaaaggcggttca
• 3′ sequencing primer: AGATCCTTGGCGGCAAGAAA

Resource Information

• Supplemental Documents:
  • pTOX5-mqsR-amilCP.ape
• A portion of this plasmid was derived from a plasmid made by: Swaine Chen lab
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry