pEDF-PhdRS
(Plasmid
#127445)
-
PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-cannonical amino acids in to M13 bacteriophage
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEVOL
-
Modifications to backboneOrigin of replication is CloDF
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
-
Alt namePylRS/Pyl-tRNA
-
SpeciesMethanosarcina mazei
-
MutationN346A-C348A mutations on PylRS
- Promoter araBAD
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEDF-PhdRS was a gift from Wenshe Liu (Addgene plasmid # 127445 ; http://n2t.net/addgene:127445 ; RRID:Addgene_127445) -
For your References section:
An amber obligate active site-directed ligand evolution technique for phage display. Tharp JM, Hampton JT, Reed CA, Ehnbom A, Chen PC, Morse JS, Kurra Y, Perez LM, Xu S, Liu WR. Nat Commun. 2020 Mar 13;11(1):1392. doi: 10.1038/s41467-020-15057-7. 10.1038/s41467-020-15057-7 PubMed 32170178