Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEDF-PhdRS
(Plasmid #127445)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127445 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEVOL
  • Modifications to backbone
    Origin of replication is CloDF
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
  • Alt name
    PylRS/Pyl-tRNA
  • Species
    Methanosarcina mazei
  • Mutation
    N346A-C348A mutations on PylRS
  • Promoter araBAD

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEDF-PhdRS was a gift from Wenshe Liu (Addgene plasmid # 127445 ; http://n2t.net/addgene:127445 ; RRID:Addgene_127445)
  • For your References section:

    An amber obligate active site-directed ligand evolution technique for phage display. Tharp JM, Hampton JT, Reed CA, Ehnbom A, Chen PC, Morse JS, Kurra Y, Perez LM, Xu S, Liu WR. Nat Commun. 2020 Mar 13;11(1):1392. doi: 10.1038/s41467-020-15057-7. 10.1038/s41467-020-15057-7 PubMed 32170178